View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1764_low_2 (Length: 408)
Name: NF1764_low_2
Description: NF1764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1764_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 15 - 402
Target Start/End: Original strand, 37859237 - 37859624
Alignment:
| Q |
15 |
accaccttcgcgatgaggcctaacatgaacaccaccaaaatcagttattgatgtgagtggtggaggaaagttacaagaagctttattaactcttctagac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37859237 |
accaccttcgcgatgaggcctaacatgaacaccaccaaaatcagttattgaagtgagtggtggaggaaagttacaagaagctttattaactcttctagac |
37859336 |
T |
|
| Q |
115 |
acacaattattcatgttgttattgttaacatcatttcttgtgtcagaagaaaataatgaaacatcaatatcactactttcaccagcattgctaccagttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37859337 |
acacaattattcatgttgttattgttaacatcatttcttgtgtcagaagaaaataatgaaacatcaatatcactactttcaccagcattgctaccagttt |
37859436 |
T |
|
| Q |
215 |
cactcccaaggctttcagtgcacatttctaagctcttttcacttagcattgatgaggaacgtttcacagtaggatgaacatagactttaccatttgcatt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37859437 |
cactcccaaggctttcagtgcacatttctaagctcttttcacttagcattgatgaggaacgtttcacagtaggatgaacatagacgttaccatttgcatt |
37859536 |
T |
|
| Q |
315 |
ttcagttttgttagtttctgttaaagcttgaaggaaactccagctagattttgtgtcannnnnnncacattcattgttgatgatgatg |
402 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37859537 |
ttcaattttgttagtttctgttaaagcttgaaggaaactccagctagattttgtgtcatttttttcacattcattgttgatgatgatg |
37859624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University