View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1764_low_4 (Length: 293)
Name: NF1764_low_4
Description: NF1764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1764_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 37557192 - 37557453
Alignment:
| Q |
17 |
ttattttatgttgatatcttgtttcattccagtacttcacttatatgcttgatatgtagatgtttggtagtttatacataatgtgattttaatttacaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557192 |
ttattttatgttgatatcttgtttcattccagcacttcacttatatgcttgatatgtagatgtttggtagtttatacataatgtgattttaatttacaac |
37557291 |
T |
 |
| Q |
117 |
tagtaatagacaaatgccttgtaaaaaccattggtctaggagaatgtattggatgtgaaattaaatcactcggtggtgacacaagttttcatcggatcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557292 |
tagtaatagacaaatgccttgtaaaaaccattggtctaggagaatgtattggatgtgaaattaaatcactcggtggtgacacaagttttcatcggatcat |
37557391 |
T |
 |
| Q |
217 |
tgtatgatgtttttattttaagatgaaaatgtgttgtttaaccttaatgtttcctttctttt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37557392 |
tgtatgatgtttttattttaagatgaaaatgtgttgtttaaccttaatgtctcctttctttt |
37557453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University