View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1764_low_6 (Length: 254)
Name: NF1764_low_6
Description: NF1764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1764_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 38175496 - 38175241
Alignment:
| Q |
1 |
ctctcttcacttcactagtcactctcatgtcttctggtttaacattgaccaacagtggtgatttgcttccactatctaccactaccacctcctcttttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38175496 |
ctctcttcacttcactagtcactctcatgtcttctggtttaacattgagcaacagcggtgatttacttccactatctaccactactacctcctcttttaa |
38175397 |
T |
 |
| Q |
101 |
ttcaaaatctttttc------------------ctcttttcttgaagaacgttgaaacttttgacccaaaagtttcttcaacatagatttaaacttaaca |
182 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38175396 |
ttcaaaatctttttcaactttgcattctttttcctcttttcttgaagaacgttgaaacttttgacccaaaagtttcttcaacatagatttaaacttaaca |
38175297 |
T |
 |
| Q |
183 |
ctattgttaactttattttcatgtaaagaaactttttcagaacaatccaatttctt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38175296 |
ctattgttaactttattttcatgtaaagaaacttttccagaacaatccaatttctt |
38175241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University