View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17650_low_1 (Length: 202)
Name: NF17650_low_1
Description: NF17650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17650_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 41743912 - 41743744
Alignment:
| Q |
17 |
aatatatgatgacaatatgtgtggtaccacgttcatatatgttttaagatgaagtccatctgcatatggatagagttgcactgctaaagtataatttaaa |
116 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41743912 |
aatatatgatgacgatatgtgtgataccacgttcatatatgtcttaagatgaagtccatctgcatatggatagagtcgcactgctaaagtataatttaaa |
41743813 |
T |
 |
| Q |
117 |
aatttacgttattaagtgataaaatgttgagtttataacaaactttttattaaatatattctttcttat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41743812 |
aatttacgttattaagtgataaaatgttgagtttataacatactttttattaaatatattctttcttat |
41743744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University