View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_101 (Length: 267)
Name: NF17651_high_101
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_101 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 123 - 249
Target Start/End: Original strand, 2766433 - 2766560
Alignment:
| Q |
123 |
caatttcttttctatggcaaacttcaatggtgttagttgttttaaaatatcaccacccnnnnnnn-gttgtgttttaaaatacaattttcaaattgtttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2766433 |
caatttcttttctatggcaaacttcaacggtgttagttgttttaaaatatcaccaccaaaaaaaaagttgtgttttaaaatacaattttcaaattgtttg |
2766532 |
T |
|
| Q |
222 |
gtgagtgatgatggagactgaatcttgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2766533 |
gtgagtgatgatggagactgaatcttgt |
2766560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 12 - 70
Target Start/End: Original strand, 2766336 - 2766394
Alignment:
| Q |
12 |
taattcttggatataaagcattttcatgaataaattaagcgcaacaatatgagagtggg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766336 |
taattcttggatataaagcattttcatgaataaattaagcgcaacaatatgagagtggg |
2766394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 25567553 - 25567512
Alignment:
| Q |
208 |
tttcaaattgtttggtgagtgatgatggagactgaatcttgt |
249 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
25567553 |
tttcaaactgtttggtgagttatgatggagactgaaccttgt |
25567512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University