View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_111 (Length: 253)
Name: NF17651_high_111
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_111 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 28586499 - 28586252
Alignment:
| Q |
1 |
aggcatacgaccttgcagccataaagtttagaggtgcaaacgctgtaaccaattttgagataagtagatacaatactgaggatatgctggatagttctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586499 |
aggcatacgaccttgcagccataaagtttagaggtgcaaacgctgtaaccaattttgagataagtagatacaatactgaggatatgctggatagttctcc |
28586400 |
T |
 |
| Q |
101 |
tccagttggtggagaagcaaaacgcttaaaaccttccgaagaatcgaagaagaaagctcctgtgactagtacctctgaacaacctgagagtacaaatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
28586399 |
tccagttggtggagaagcaaaacgcttaaaaccttccgaagaatcgaagaagaaagctcctgtgactagtacctctgaacaacccgatagtacaaatatg |
28586300 |
T |
 |
| Q |
201 |
aatagcagcatcgattttctgccaattgcttctgaaccctatgcttct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28586299 |
aatagcagcatcgattttctgccaattgcttctgaaccctatgattct |
28586252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University