View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_120 (Length: 247)
Name: NF17651_high_120
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_120 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 12675905 - 12675791
Alignment:
| Q |
1 |
taaataatcaaaactatttgacatctcaatcaaccatgaaatacaataaaggatcatcggagacatgattgctctacacatataggctatagcactaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12675905 |
taaataatcaaaactatttgacatctcaatcaaccatgaaatacaataaaggatcatcggagacatgattgctctacacatataggctatagcactaaac |
12675806 |
T |
 |
| Q |
101 |
aatttttcattggac |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12675805 |
aatttttcattggac |
12675791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 173 - 247
Target Start/End: Complemental strand, 12675733 - 12675659
Alignment:
| Q |
173 |
ggtgctacaatagcaccatgtgacacatggtacaaacaagttcctgacttcttatactctttggtcacatttata |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
12675733 |
ggtgctacaatagcaccatgtgacacatggtacaaacaaattcctggcttcttatactctttggtcacatttata |
12675659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University