View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_126 (Length: 244)
Name: NF17651_high_126
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_126 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 13812555 - 13812340
Alignment:
| Q |
18 |
agatgtactggatgatttcttcacaccagatgaacaatcagtttgaacatcatcccccatactcattggcacaggaaccaacccacttgattcagaatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13812555 |
agatgtactggatgatttcttcacaccagatgaacaatcagtttgaacatcatcccccatactcattggcacaggaaccaacccacttgattcagaatca |
13812456 |
T |
|
| Q |
118 |
attggcaatggagttcggctagctgctttctgtctcaaagctaaaccctttcctgttcttgaaggaagaccaccactgctgctattatcctccctcagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13812455 |
attggcaatggagttcggctagctgctttctgtctcaaagctaaaccctttcctgttcttgaaggaagaccaccactgctgctattatcctccctcagaa |
13812356 |
T |
|
| Q |
218 |
tcaactctggtattct |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13812355 |
tcaactctggtattct |
13812340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University