View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_127 (Length: 238)
Name: NF17651_high_127
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_127 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 55 - 238
Target Start/End: Complemental strand, 10318050 - 10317867
Alignment:
| Q |
55 |
caaagaaatgcattttccatcctccaattgttcgaaggatatggaactaactctgctcaaactattagtcccacaaagtgtaaaatttttgtaggagcct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10318050 |
caaagaaatgcattttccatcctccaattgttcgaaggatatggaactaactctgctcaaactattagtcccacaaagtgtaaaatttttgtaggagcct |
10317951 |
T |
 |
| Q |
155 |
cagtatttacaactagattgaattccccgactaagattacagggtttactttaggctcaactccttttagctatccaagtgctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10317950 |
cagtatttacaactagattgaattccccgactaagattatagggtttactttaggctcaactccttttagctatctaagtgctc |
10317867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University