View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_128 (Length: 238)
Name: NF17651_high_128
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_128 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 220
Target Start/End: Complemental strand, 22685600 - 22685490
Alignment:
| Q |
110 |
gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgagattttaatctcga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22685600 |
gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgatattttaatctcga |
22685501 |
T |
 |
| Q |
210 |
tcatgatatct |
220 |
Q |
| |
|
||||| ||||| |
|
|
| T |
22685500 |
tcatggtatct |
22685490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 220
Target Start/End: Original strand, 22753468 - 22753578
Alignment:
| Q |
110 |
gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgagattttaatctcga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22753468 |
gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgatattttaatctcga |
22753567 |
T |
 |
| Q |
210 |
tcatgatatct |
220 |
Q |
| |
|
||||| ||||| |
|
|
| T |
22753568 |
tcatggtatct |
22753578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University