View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_140 (Length: 218)
Name: NF17651_high_140
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_140 |
 |  |
|
| [»] scaffold0038 (5 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0038 (Bit Score: 49; Significance: 3e-19; HSPs: 5)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 47569 - 47513
Alignment:
| Q |
146 |
tatcattattatttatgttcttcaaatgatttctcttttcactttgagttatgatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
47569 |
tatcattattatttatgttcttcaaatgatttctctctccactttgagttatgatct |
47513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 47751 - 47698
Alignment:
| Q |
149 |
cattattatttatgttcttcaaatgatttctcttttcactttgagttatgatct |
202 |
Q |
| |
|
||||||||||||||||||| |||||||| |||| | |||||||||||||||||| |
|
|
| T |
47751 |
cattattatttatgttctttaaatgattgctctctccactttgagttatgatct |
47698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 29063 - 29099
Alignment:
| Q |
66 |
tgtcaacagagataatgtaaatatgtaattttaatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29063 |
tgtcaacagagataatgtaaatatgtaattttaatta |
29099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 77 - 133
Target Start/End: Original strand, 47241 - 47297
Alignment:
| Q |
77 |
ataatgtaaatatgtaattttaattatgtgtgcgtacttattttgttacatattatc |
133 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
47241 |
ataatgtaaatatctaattttaattctgtgtgcttatttattatgttacatattatc |
47297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 101
Target Start/End: Original strand, 40184 - 40220
Alignment:
| Q |
65 |
gtgtcaacagagataatgtaaatatgtaattttaatt |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40184 |
gtgtcaacactgataatgtaaatatgtaattttaatt |
40220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 3e-19; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 28247407 - 28247351
Alignment:
| Q |
146 |
tatcattattatttatgttcttcaaatgatttctcttttcactttgagttatgatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
28247407 |
tatcattattatttatgttcttcaaatgatttctctctccactttgagttatgatct |
28247351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 149 - 202
Target Start/End: Complemental strand, 28247589 - 28247536
Alignment:
| Q |
149 |
cattattatttatgttcttcaaatgatttctcttttcactttgagttatgatct |
202 |
Q |
| |
|
||||||||||||||||||| |||||||| |||| | |||||||||||||||||| |
|
|
| T |
28247589 |
cattattatttatgttctttaaatgattgctctctccactttgagttatgatct |
28247536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 28228565 - 28228601
Alignment:
| Q |
66 |
tgtcaacagagataatgtaaatatgtaattttaatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28228565 |
tgtcaacagagataatgtaaatatgtaattttaatta |
28228601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 77 - 133
Target Start/End: Original strand, 28247079 - 28247135
Alignment:
| Q |
77 |
ataatgtaaatatgtaattttaattatgtgtgcgtacttattttgttacatattatc |
133 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
28247079 |
ataatgtaaatatctaattttaattctgtgtgcttatttattatgttacatattatc |
28247135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 101
Target Start/End: Original strand, 28240022 - 28240058
Alignment:
| Q |
65 |
gtgtcaacagagataatgtaaatatgtaattttaatt |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28240022 |
gtgtcaacactgataatgtaaatatgtaattttaatt |
28240058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University