View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_22 (Length: 475)
Name: NF17651_high_22
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 443; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 1 - 463
Target Start/End: Complemental strand, 5445412 - 5444950
Alignment:
| Q |
1 |
ttcggaacaactttaaaaggccaaagctttatgtcttgttggactgtttggtcagagaatcgacggccaatcagacgtttggcatcaaaaacagtgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445412 |
ttcggaacaactttaaaaggccaaagctttatgtcttgttggactgtttggtcagagaatcgacggccaatcagacgtttggcatcaaaaacagtgttgt |
5445313 |
T |
|
| Q |
101 |
ggggatttttggctaattggtttttggcagcatcgcctattaatctttcagtgtcggtgaaggcaacgtaagaaggggtgacacggttcccttggtcgtt |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445312 |
ggggatatttggctaattggtttttggcagcatcgcctattaatctttcagtgtcagtgaaggcaacgtaagaaggggtgacacggttcccttggtcgtt |
5445213 |
T |
|
| Q |
201 |
tggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgttgccattgca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445212 |
tggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgttgccattgca |
5445113 |
T |
|
| Q |
301 |
cttaatttgagaggagagaacaaaagaagaatggcgttttggttagtgaactgagaatatggatctgattgatcaaaaggtagtttttataggcctaaga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5445112 |
cttaatttgagaggagagaacaaaagaagaatggtgttttggttagtgaaccgagaatatggatctgattgatcaaaaggtagtttttataggcataaga |
5445013 |
T |
|
| Q |
401 |
gaacatttttcagaaaagttggggaatgaggaaggagtatggaaaatatacacggagaataat |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5445012 |
gaacatttttcagaaaagttggggaatgaggaaggagtatggaaaatatacacggagaataat |
5444950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 191 - 378
Target Start/End: Original strand, 5440993 - 5441182
Alignment:
| Q |
191 |
cttggtcgtttggaatgatctcaacacgattgtttcgccacactgcaatgcagctgtagcttgtaccaaggtcaatgcctatggctttgctttttcttgt |
290 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||| || ||||||||||||| |||| |||| ||| ||||| |||||||| |||||| || | |
|
|
| T |
5440993 |
cttggtcgtttggaatgatctcaacatgattgtgttgccactctcaaatgcagctgtaggttgtgccaatgtcgatgccaatggcttttctttttgttat |
5441092 |
T |
|
| Q |
291 |
tgccattgca---cttaatttgagaggagagaacaaaagaagaatggcgttttggttagtgaactgagaatatggatctgattgatcaaaa |
378 |
Q |
| |
|
||||| || | ||||||||||||||||||||||| |||| ||||||| |||| |||||| ||| ||||| |||||||| |||| |
|
|
| T |
5441093 |
tgccacgacaaacgagagtttgagaggagagaacaaaagaa-aatgatgttttgggtagtaaactgaaaatctggatgtgattgataaaaa |
5441182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University