View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_25 (Length: 446)
Name: NF17651_high_25
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 19 - 437
Target Start/End: Complemental strand, 5436391 - 5435973
Alignment:
| Q |
19 |
ggctaagcatactaatctagaggttcagttagaggatttcactgctgaggggttgatgcatatgaattggaattaggagagtttgatatgtttctgggag |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436391 |
ggctaagcatactaatctagaggtacagttagaggatttcactgctgaggggttgatgcatatgaattggaattaggagagtttgatatgtttctgggag |
5436292 |
T |
 |
| Q |
119 |
tggcttggttggaaaagcttggcaattaggtggtatttgactgggatgagaggacaatatgttttgaatggaagggtgaggttgtgaagctgcaaggtca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436291 |
tggcttggttggaaaagcttggcaattaggtggtatttgactgggatgagaggacaatttgttttgaatggaagggtgaggttgtgaagctgcaaggtca |
5436192 |
T |
 |
| Q |
219 |
aatcctcaaggattggaaaattaaacgaggcagaaaaaacgagctatcgtgaaagcactgcaacagccaattaaagtcacaaggaaagaaggaaataaag |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436191 |
aatcctcaaggattggaaaattaaacgaggcggaaaaaacgagctatcgtgaaagcactgcaacagccaattaaagtcacaaggaaagaaggaaataaag |
5436092 |
T |
 |
| Q |
319 |
aaaacataagtggagaacttggnnnnnnngaaggatcaaggtcttcatggtagccttgaggacagggttaattttgaaggaggaggtaatgataggacac |
418 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5436091 |
aaaacataagtggagaacttggtttttttgaaggatcaaggtcttcatggtagccttgaagacagggttaattttgaaggaggaggtaatgataggacac |
5435992 |
T |
 |
| Q |
419 |
caaagtccaatagtattat |
437 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5435991 |
caaagtccaatagtattat |
5435973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University