View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_high_56 (Length: 379)
Name: NF17651_high_56
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_high_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 24 - 138
Target Start/End: Complemental strand, 2623370 - 2623262
Alignment:
| Q |
24 |
ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaacttcaacttcaacgagaagagaataaatagaaaaacttttatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2623370 |
ttggagagcaataatcaggtaccttttttactagactaacaacggcggaggagtcaactt------caacgagaagagaataaatagaaaaacttttatt |
2623277 |
T |
|
| Q |
124 |
gagcttcaagccaag |
138 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2623276 |
gagcttcaagccaag |
2623262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University