View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_102 (Length: 271)
Name: NF17651_low_102
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_102 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 1936494 - 1936256
Alignment:
| Q |
18 |
atcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaattttagagatgacaaatgttccaatcattcacgcaggttgtagatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936494 |
atcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaattttagagatgacaaatgttccaatcattcacgcaggttgtagatg |
1936395 |
T |
|
| Q |
118 |
tgaactgctcacatggaataacagtcttcaattgcaatctgtgatcctaaaagtgaggacaacttttccctaaattgtagactttatgttctgttcagca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936394 |
tgaactgctcacatggaataacagtcttcaattgcaatctgtgatcctaaaagtgaggacaacttttccctaaattgtagactttatgttctgttcagca |
1936295 |
T |
|
| Q |
218 |
ctattgggaattaatgtaagtactcttttaatgaaatct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936294 |
ctattgggaattaatgtaagtactcttttaatgaaatct |
1936256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University