View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_107 (Length: 264)
Name: NF17651_low_107
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 176 - 253
Target Start/End: Complemental strand, 38278768 - 38278690
Alignment:
| Q |
176 |
aatatagacaaatgtaatggttttctaactatcaaacttt-aatctcattcttagtatttcttcgtcatctcaattcat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38278768 |
aatatagacaaatgtaatggttttctaactatcaaactttgaatctcattcttagtatttcttcgtcatctcaattcat |
38278690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University