View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_109 (Length: 264)
Name: NF17651_low_109
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_109 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 52 - 264
Target Start/End: Complemental strand, 12676107 - 12675896
Alignment:
| Q |
52 |
tactctaccttttcttgtctgtctttctcccttttttgctactttgttgaaaaaatatcagaaagttagatccttcaactcacatggaagcacttaattc |
151 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12676107 |
tactctaccgtttcttgtttgtctttctcc-ttttttgctactttgttgaaaaaatatcagaaagttagatccttcaactcacatggaagcacttaattc |
12676009 |
T |
 |
| Q |
152 |
catattagttagggtttccaattcacccaacaaagtttggtactcatccaccaaattaaatttcgtatgtacctaagtgttcacctcaaataatactata |
251 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12676008 |
caaattagttagggtttctaattcacccaacaaagtttggtactcatccaccaaattaaatttcttatgtacctaagtgttcacctcaaataatactata |
12675909 |
T |
 |
| Q |
252 |
ccttaaataatca |
264 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12675908 |
ccttaaataatca |
12675896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 12676184 - 12676145
Alignment:
| Q |
13 |
aatatcttactcttgtggtgcaccttgatcttatcatatt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12676184 |
aatatcttactcttgtggtgcaccttgatcttatcatatt |
12676145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University