View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_112 (Length: 258)
Name: NF17651_low_112
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_112 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 9822001 - 9821781
Alignment:
| Q |
19 |
ggtttagttttcttcttcgacaagtttgatgggccgcaaaactgtttttgaagcacaaggcgaactcaacgatgcctatatatacaagacacttgttttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9822001 |
ggtttagttttcttcttcgacaagtttgatgggccgcaaaactgtttttgaagcacaaggcgaactcaacgatgcctatatatacaagacacttgttttc |
9821902 |
T |
 |
| Q |
119 |
agttctaacttgaagtaggagtgaagcaaactaggcttcatcaaaataaagaactcttagctagtcaaaagttaagaatcgagtgnnnnnnnggtagact |
218 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
9821901 |
agttctaacttgaggtaagagtgaagcaaactaggcttcatcaaaataaaaaattcttagctagtcaaaagttaagaatcgagtgtttttgtggtacact |
9821802 |
T |
 |
| Q |
219 |
cttggattttgaattattcta |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9821801 |
cttggattttgaattattcta |
9821781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 131
Target Start/End: Complemental strand, 38985082 - 38984971
Alignment:
| Q |
20 |
gtttagttttcttcttcgacaagtttgatgggccgcaaaactgtttttgaagcacaaggcgaactcaacgatgcctatatatacaagacacttgttttca |
119 |
Q |
| |
|
|||| |||||||| ||||| || ||||||||||||||||||| ||| | ||||||||||| |||||| | ||| | |||||||| |||||||||||| | |
|
|
| T |
38985082 |
gttttgttttcttgttcgataaatttgatgggccgcaaaactatttctaaagcacaaggcaaactcagtggtgcttgtatatacaggacacttgttttaa |
38984983 |
T |
 |
| Q |
120 |
gttctaacttga |
131 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38984982 |
gttctaacttga |
38984971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University