View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_127 (Length: 247)
Name: NF17651_low_127
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_127 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 44246717 - 44246946
Alignment:
| Q |
1 |
ctttgtctccgtgtcttacgtccatgtctttctcttcttctctcactcaatgcactgtatgtgacagattc----attctaattctattatattcttttc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44246717 |
ctttgtctccgtgtcttacgtccatgtctttctcttcttctctcactcaatgcactgtatgtgacagattcattcattctaattctattatattcttttc |
44246816 |
T |
 |
| Q |
97 |
tataccaaataaatacgtactgtattacgcagtcattttctctcttcggactaagcaaagccatttgcaaatttccatccattggtttctgttttgtgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44246817 |
tataccaaataaatacgtactgtattacgcagtcattttctctcttcggactaagcaaagccatttgcaaatttccatccattggtttctgttttgtgta |
44246916 |
T |
 |
| Q |
197 |
ctattatacatacattccaactgtgccggccatg |
230 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
44246917 |
ctatt----atacattccaactgtgccggccatg |
44246946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University