View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17651_low_133 (Length: 238)

Name: NF17651_low_133
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17651_low_133
NF17651_low_133
[»] chr6 (2 HSPs)
chr6 (110-220)||(22685490-22685600)
chr6 (110-220)||(22753468-22753578)


Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 220
Target Start/End: Complemental strand, 22685600 - 22685490
Alignment:
110 gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgagattttaatctcga 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
22685600 gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgatattttaatctcga 22685501  T
210 tcatgatatct 220  Q
    ||||| |||||    
22685500 tcatggtatct 22685490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 220
Target Start/End: Original strand, 22753468 - 22753578
Alignment:
110 gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgagattttaatctcga 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
22753468 gtgaatatcttatcaaccgaagtatttttcaagataaataaaataacaataattactggaaaatcacttataagtaaaagagccgatattttaatctcga 22753567  T
210 tcatgatatct 220  Q
    ||||| |||||    
22753568 tcatggtatct 22753578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University