View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_134 (Length: 232)
Name: NF17651_low_134
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_134 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 34686666 - 34686468
Alignment:
| Q |
14 |
gcatagggtaagttagatatatactatactatg--tgatagtcattttggtctctgaatgcatatataataagttaaatactatactatactccataaaa |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34686666 |
gcatagggtaagttagatat----tatactatgagtgatggtcattttggtctctgaatgcatatataataagttaaatactatactatactccataaaa |
34686571 |
T |
 |
| Q |
112 |
caaatatattgcttgttttggtatttataaaatgttgtttcatacatactaaatgttgcattgaactttaaaacgacaatgaaaaaagaatctgagggat |
211 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
34686570 |
caaatatattggttgttttggtatttatgaaatgttgtttcatacatact-aatgttgcattgaactttaaaacgacaattaaaaaagaat-agagggat |
34686473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University