View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_135 (Length: 231)
Name: NF17651_low_135
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_135 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 47162680 - 47162477
Alignment:
| Q |
1 |
atagagatatctgaaagttgagataacaaatcaattatagtaatattacttactattctgggggtaaaacctttagatgaaatgaaactagtactctcct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162680 |
atagagatatctgaaagttgagatcacaaatcaattatagtaatattacttactattctgggagtaaaacctttagatgaaatgaaactagtactctcct |
47162581 |
T |
 |
| Q |
101 |
aagtttggtttctgtaacaaatcgtaccaagaaactggtcttgtctggttggaaac---ataacttgaataaactgtttgaaatctagagtctcctttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47162580 |
aagtttggtttctgtaacaaatcgtaccaagaaactggtcttgtctggttggaaacataataacttgaataaactgtttgaaatctagagtctcccttca |
47162481 |
T |
 |
| Q |
198 |
ttca |
201 |
Q |
| |
|
|||| |
|
|
| T |
47162480 |
ttca |
47162477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University