View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_138 (Length: 227)
Name: NF17651_low_138
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_138 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 7794014 - 7794205
Alignment:
| Q |
17 |
aatattgaagatgatgtgatctaaaataaagataatagaaagggagacaattttactcttgaaatcttcagatttttagagtaggtttagattcacggcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7794014 |
aatattgaagatgatgtgatctaaaataaagataatagaaagggagacaattttactcttgaaatcttcagatttttagagtaggtttagattcacggcg |
7794113 |
T |
 |
| Q |
117 |
aactgcaaaaaatatactttgaagcttctataaaaccaccacatcattatgatttgatcaaacttacagagatttcaaacatatactaaatac |
209 |
Q |
| |
|
|||||| |||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7794114 |
aactgc-aaaactatactttgaagcttctatagaaccaccacatcactatgatttgatcaaacttacaaagatttcaaacatatactaaatac |
7794205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University