View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_33 (Length: 423)
Name: NF17651_low_33
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 120 - 402
Target Start/End: Original strand, 47162188 - 47162469
Alignment:
| Q |
120 |
tgttgcatcaaaatgataatgtacaagtgagctttgatggaagtgaagtgatgatgagaaagaaagaaacaaatatgctatatttttctcctctacctgt |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47162188 |
tgttgcataaaaatgataatgtacaagtgagctttgatggaagtgaagtgatgatgagaaagaaagaaacaaatctgctatatttttctcctctacctgt |
47162287 |
T |
 |
| Q |
220 |
gattgtaatgcagtgcagtggaaacaccgtgtttcctgcttcttcttctgctgctgcacagtactactacagatatatactacagtattatctcagt--t |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||| | |
|
|
| T |
47162288 |
gattgtaatgcagtgcagtggaaacaccgtgtttcctgcttcttcttctgctgatgcacag---tactacagatataaactacagtattatctcagtaat |
47162384 |
T |
 |
| Q |
318 |
ttctacctatttaatggtttctgtattttcggtgctaaatgagagagtaaccagtaaccactggcaaacacttcaaattgggaac |
402 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162385 |
ttctacctatttaatggtttctgtatttttggtgctaaatgagagagtaaccagtaaccactggcaaacacttcaaattgggaac |
47162469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Original strand, 47162077 - 47162124
Alignment:
| Q |
17 |
aaaaataacataattcttattaaatctactgtgttattgtaatgatag |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162077 |
aaaaataacataattcttattaaatctactgtgttattgtaatgatag |
47162124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University