View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_36 (Length: 414)
Name: NF17651_low_36
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 399
Target Start/End: Complemental strand, 3438607 - 3438213
Alignment:
| Q |
1 |
actgatatataaacggaaagttggggaggaataaacggaagcccgtaaacggtggttaagtggagtacatgtcgtgataatttgcatattgattcttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438607 |
actgatatataaacggaaagttggggaggaataaacggaagcccgtaagcggtggttaagtggagtacatgtcgtgataatttgcatattgattcttccc |
3438508 |
T |
|
| Q |
101 |
tagggataacatttttctttatacaacatatacataaagtgcatattcctcgtgaaatgcatgcaggaatgaaattaatttcttgcatgttttgtgtatg |
200 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438507 |
tggggataacatttttctttataca---tatacataaagtgcatattcctcgtgaaatgcatgcaggaatgaaattaatttcttgcatgttttgtgtatg |
3438411 |
T |
|
| Q |
201 |
ctttcacatttgcttttggaattgtagtagaccaacaaacgggaagttgaaacactttgaattttgattagtgcatagtgtgagttagatagtataggtg |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3438410 |
ctttcacatttgcttttggaactgtagtagaccaacaaacgggaagttgaa-caatttgaattttgattaatgcatcgtgtgagttagatagtataggtg |
3438312 |
T |
|
| Q |
301 |
tcacgtttttattagtgcttcaaaatttcaaaaggtcgtgatttggtttaattcggtcaatgattttgattgaattggcaaattttgtgtattaatgat |
399 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438311 |
tcacgtttttatcagtgcttcaaaatttcaaaaggtcgtgatttggtttaattcggtcaatgattttgattgaattggcaaattttgtgtattaatgat |
3438213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University