View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_41 (Length: 409)
Name: NF17651_low_41
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 32637008 - 32636783
Alignment:
| Q |
5 |
caaaatagtatatggcagggaaagattgatatccatcccacacaatttccttctctaactcttcatgtaaccatcatgataaatcaatctatttctccta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||| | || | ||||||||||||| |
|
|
| T |
32637008 |
caaaatagtatatggcagggaaagattgatatccattccacgcaatttccttctctaactctttatgtaaccatcatgacagattagtctatttctccta |
32636909 |
T |
 |
| Q |
105 |
atgt---caattgtaaccctggtaattatttggtaatgttagcatgtataaggatttgataaccaagcaggtattcaactacaaattgaagattatctaa |
201 |
Q |
| |
|
| || |||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
32636908 |
aagtagtcaatcataaccctggtaattgattggtaatgttagcatgtataaggctttgataaccaagcaggtactcaaccacaaattgaagattatctaa |
32636809 |
T |
 |
| Q |
202 |
ggtgctctttcgatgactgtccaaaa |
227 |
Q |
| |
|
|||||||||| ||||||||| ||||| |
|
|
| T |
32636808 |
ggtgctcttttgatgactgttcaaaa |
32636783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 283 - 392
Target Start/End: Complemental strand, 32636780 - 32636671
Alignment:
| Q |
283 |
tggatgtaatacaaactcttcttttggtacattattcgacttatttaaacattagaacttggctaagtctgtctcgcaatgctaggagacccctgcatca |
382 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||| || |||| |||||||| |||||||||||||||| |
|
|
| T |
32636780 |
tggatgtaatacaaaatcttcttttggtacgttattcaacttatttaaacattagaacttggctaactccgtcttgcaatgcttggagacccctgcatca |
32636681 |
T |
 |
| Q |
383 |
taggcaaaat |
392 |
Q |
| |
|
|| ||||||| |
|
|
| T |
32636680 |
taagcaaaat |
32636671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 197 - 292
Target Start/End: Complemental strand, 31926597 - 31926501
Alignment:
| Q |
197 |
tctaaggtgctctttcgatgactgtccaaaagtttcctagtttttactatccaa-gctgaattgatttcaggcagttcatagtcatctggatgtaat |
292 |
Q |
| |
|
||||||||| |||||| ||| || || || |||||| | |||||||||||| | |||| || |||||||||| |||||| ||||||||||||||| |
|
|
| T |
31926597 |
tctaaggtgttctttcaatggttgccctaatgtttcccaatttttactatcccatgctggatcaatttcaggcaattcatactcatctggatgtaat |
31926501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University