View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_64 (Length: 362)
Name: NF17651_low_64
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 69 - 159
Target Start/End: Original strand, 8231327 - 8231417
Alignment:
| Q |
69 |
acaaccatgatatttggaaacctaatttttctctatggtcataaaaaccgtattttatggatctagataatagaccaatcccctcttgtta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8231327 |
acaaccatgatatttggaaacctaatttttctctatggtcataaaaaccgtattttatggatctagatcatagaccaatcccctcttgtta |
8231417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 291 - 354
Target Start/End: Original strand, 8231520 - 8231583
Alignment:
| Q |
291 |
caaccggtggtccaaatcttcattttatctctattgttttctttttatttctatcatagtatta |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
8231520 |
caaccggtggtccaaatcttcattttatctctatcgttttctttttatttctatcatattatta |
8231583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 8231473 - 8231524
Alignment:
| Q |
216 |
gtctctctccttcatactcaccaaaccacacttacagacagttctcccccgcaacc |
271 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
8231473 |
gtctctctccttcatactcacgaaaccatactt----acagttctcccccgcaacc |
8231524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University