View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_75 (Length: 333)
Name: NF17651_low_75
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_75 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 193 - 333
Target Start/End: Complemental strand, 12820897 - 12820758
Alignment:
| Q |
193 |
gcacgttcagtttccagtgtcataacttttccactgaatcatctactagaaaacccctcattgatcactgtggacagcgactgttacaaacgactcgagt |
292 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||| |
|
|
| T |
12820897 |
gcacgttcagtttccagtgtcgtaacttttccactgaatcgtctactagaaaacccctcattgatcaccgtcgacagcgactgttacaaac-actcgagt |
12820799 |
T |
|
| Q |
293 |
ttaataacttcacccgaatggttggttcatgtaatggattg |
333 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12820798 |
ttaataatttcacccgaatggttggttcatgtaatggattg |
12820758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 79 - 141
Target Start/End: Complemental strand, 19638060 - 19638001
Alignment:
| Q |
79 |
tgtgtctgcaagtcatggaacacactcatctcttccgatcccactttcgtcaaattgcacctt |
141 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
19638060 |
tgtgtctgcaagtcatggaaaaccatcatctct---gatcccacttttgtcaaattacacctt |
19638001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 63 - 138
Target Start/End: Original strand, 553757 - 553829
Alignment:
| Q |
63 |
tcttatgcgaataaggtgtgtctgcaagtcatggaacacactcatctcttccgatcccactttcgtcaaattgcac |
138 |
Q |
| |
|
|||||||||||| | |||||| ||||| ||||||||||| ||||||||| ||||| |||||| ||||| ||||| |
|
|
| T |
553757 |
tcttatgcgaatgaagtgtgtttgcaaatcatggaacaccctcatctct---gatccaactttcatcaaaatgcac |
553829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 110
Target Start/End: Complemental strand, 5437732 - 5437680
Alignment:
| Q |
58 |
aaatctcttatgcgaataaggtgtgtctgcaagtcatggaacacactcatctc |
110 |
Q |
| |
|
|||| |||||||| ||| | |||||| ||||||||||||||||| |||||||| |
|
|
| T |
5437732 |
aaatatcttatgcaaatgaagtgtgtttgcaagtcatggaacaccctcatctc |
5437680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University