View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_85 (Length: 303)
Name: NF17651_low_85
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 23 - 283
Target Start/End: Complemental strand, 14243754 - 14243494
Alignment:
| Q |
23 |
acattttccatcacaaccaacaccatcaatatgaacgaacctaacaacaatgaggtggttcgttgtaaataagagagactctcccaaacccaaatgtgca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14243754 |
acattttccatcacaaccaacaccatcaatctgaacgaacctaacaacaatgaggtggttcattgtaaataagacagactctcccaaacccaaatgtgca |
14243655 |
T |
 |
| Q |
123 |
gccatagcttctaccatttttattgctttctcaaaatctttgtcttttctaattctcactattggccccacccatcccaccaacatcgaaacctctaagg |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14243654 |
gccatagcttctaccatttttattactttctcaaaatctttgtcttttctaattctcactattggccccacccatcccaccaacatcgaaacctctaagg |
14243555 |
T |
 |
| Q |
223 |
ttcaaaatcgatatttatatgtttctcttggatgacaaaatcgaaacccctaagactatcc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14243554 |
ttcaaaatcgatatttatatgtttctcttgggtgacaaaatcgaaacccctaagactatcc |
14243494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 168
Target Start/End: Complemental strand, 54531545 - 54531456
Alignment:
| Q |
78 |
tggttcgttgtaaataagagagactctcccaaacccaaatgtgcagccatagcttctaccatttttattgctttctcaaaatctttgtctt |
168 |
Q |
| |
|
|||||| || ||||||||| ||||||||||| ||||||||| || |||||||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
54531545 |
tggttcattataaataagatagactctcccacacccaaatg-gcggccatagcttctgccattgttattgctttctcaaaatcttcgtctt |
54531456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University