View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_86 (Length: 301)
Name: NF17651_low_86
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 10 - 285
Target Start/End: Original strand, 50451318 - 50451595
Alignment:
| Q |
10 |
acatcatcaccgccttctctaaaccacatatatatcacttgattgatttgtattatttttatattgtcacatctttcaatggttttcttaggaaatatgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50451318 |
acatcatcaccgccttctctaaaccacatatatatcacttgattgatttgtattatttttatattgtcacatctttcaatggttttcttaggaaatatgg |
50451417 |
T |
 |
| Q |
110 |
ttgatacatgatctgannnnnnnnnnnnnnatgatcatatacatgttatgaacatatcttaataaggtgggaccaagtgtaatcagatgatggtagataa |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50451418 |
ttgatacatgatctgattttttatttttttatgatcatatacatgttatgaacatatcttaataaggtgggaccaagtgtaatcagatgatggtagataa |
50451517 |
T |
 |
| Q |
210 |
caaaatgcttcatttgtgtggga--gtgtctcaagcaagcatcacttaaacaaaaactagattatggttgcaataaaa |
285 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50451518 |
caaaatgcttcatttgtgtgggagtgtgtctcaagcaagcatcacttaaacaaaaactagattatcgttgcaataaaa |
50451595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University