View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_89 (Length: 299)
Name: NF17651_low_89
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 33916350 - 33916098
Alignment:
| Q |
7 |
aaataaatctttgaggttgtaatcaagtatttacaaagaaaaaatctccggttgttatatgatcctcatgaataggcctcatgtcttttgtgcaaaagag |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33916350 |
aaataagtctttgaggttgtaatcaagtatttacaaagaaaaaacctccggttgttatatgatcctcatgaataggcctcatgtcttttgtgcaaaacag |
33916251 |
T |
|
| Q |
107 |
agaacgaatcacaaatgggagcactacaagatgctgagtgaagcttcttatcccatacttcacatgtttagagatgtgtggcactttttcaacatatgaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33916250 |
agaacgaatcacaaatgggagcactacaagatgctgagtaaagcttcttatcccatacttcacatgtttagagatgtgtggcactttttcaacatatgaa |
33916151 |
T |
|
| Q |
207 |
aaatatatcaatatannnnnnnnagaggataaatatatcaatattgatcacca |
259 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33916150 |
aaatatatcaatattttttttttagaggataaatatatcaatattgatcacca |
33916098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University