View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_94 (Length: 282)
Name: NF17651_low_94
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 2161666 - 2161451
Alignment:
| Q |
17 |
cagagaacgatataaaagggaaacttagcttctataggacaatgatcaaattttctacatacactcacctgacaagggaaaaaccctaggattgtgttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2161666 |
cagagaacgatataaaagggaaacttagcttcta--ggacaatgatcaaattttctacatacactcacctgacaagggaaaaaccctaggactgtgttct |
2161569 |
T |
 |
| Q |
117 |
agaccgaaactggtcgtatcacacaaagccaactcccaaccccaaaaagtaaatattgttaagcaaactcacaactgatcaattgaaacgcagacatcca |
216 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2161568 |
agaccgaaacgggtcatatcacgcaaagccaactcccaaccccaaatagtaaatattgttaagcaaactcacaactgatcaattgaaacgcagatatcca |
2161469 |
T |
 |
| Q |
217 |
atttaccgaatctacgag |
234 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
2161468 |
atttacggaatctacgag |
2161451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University