View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17651_low_99 (Length: 275)
Name: NF17651_low_99
Description: NF17651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17651_low_99 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 36148012 - 36148286
Alignment:
| Q |
1 |
tcactcagttatgggtcggtactaagttttgacgcaactgaactcgatccggaaaactcattatctggttttctggaccgagttccgtttagtctacgac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36148012 |
tcactgagttatgggtcggtactaagttttgacgcaactgaactcgatccagaaaactcattatctggttttctggaccgagttccgtttagtctacgac |
36148111 |
T |
 |
| Q |
101 |
gctgggcatgttacccaatgctacttggtcgtgttcgacgcaacttcaaacacgtgatgcttgtagacacaaaaacaattctcattcttcgtgacccgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36148112 |
gctgggcatgttacccaatgctacttggtcgtgttcgacgcaacttcaaacacgtgatgcttttagacacaaaaacaattctcattcttcgtgacccgtt |
36148211 |
T |
 |
| Q |
201 |
taaccgagtcaagaatcggagtccagaatcggttttactcttcaacaaacacggaaaaaagattcagtcaagcac |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36148212 |
taaccgagtcaagaatcggagtccagaatcggttttactcttcaacaaacacggaaaaaagcttcagtcaagcac |
36148286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University