View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17652_low_4 (Length: 286)
Name: NF17652_low_4
Description: NF17652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17652_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 273
Target Start/End: Complemental strand, 23306112 - 23305858
Alignment:
| Q |
20 |
ttatacctagtcgataaaggttgattctatacccatctcagttggcttaacggtgtgcttgagtagttgaagtatgcttctctcaagatctcaaatttga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23306112 |
ttatacctagtcgataaaggttgattctatacccatctcagttggcttaacggtgtgcttgagtagttgaagtatgcttctctcaagatctcaaattcga |
23306013 |
T |
 |
| Q |
120 |
ttccacacgtgctaatttcggatt-ggttagtccatgctttaaatgaggcctcgcaagtggacaaagagattcaaccatgagattagtcggtgggccgga |
218 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23306012 |
ttccacacgtgctaatttcgggtttggttagtccatgctttaaatggggcctcgcaagtggacaaagagattcaaccatgagattagtcggtgggccgga |
23305913 |
T |
 |
| Q |
219 |
taccaagtttataaaagaaaatcgattgcatgcgaatgtcattatccatgtagaa |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23305912 |
taccaagtttataaaagaaaatcgattgcatgcgaatgtcattatccatgtagaa |
23305858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 122
Target Start/End: Complemental strand, 22693211 - 22693175
Alignment:
| Q |
86 |
ttgaagtatgcttctctcaagatctcaaatttgattc |
122 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
22693211 |
ttgaagtgtgcttctctcaagatctcatatttgattc |
22693175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University