View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17653_high_8 (Length: 228)
Name: NF17653_high_8
Description: NF17653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17653_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 53699288 - 53699483
Alignment:
| Q |
15 |
cagagaccattcagccataagcttgaatatgccaaattgaaaagatgcaaatcaaagaaatgagttcaaacatctttccaccataagcttgaataggcca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53699288 |
cagagaccattcagccataagcttgaatatgccaaattgaaaagatgcaaatcaaagaaatgagttcaaacatctttccaccataagcttgaataggcca |
53699387 |
T |
 |
| Q |
115 |
attcaaataaatctttcaaggtaggaggatattgataaaatgaccgcttcaatata-ttattaactgttgttgttcgagaaagtctttgataattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53699388 |
attcaaataaatctttcaaggtaggaggatattgataaaatgaccgcttcaatatatttattaactgttgttgttcgagaaagtctttgataattt |
53699483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University