View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17653_low_5 (Length: 240)
Name: NF17653_low_5
Description: NF17653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17653_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 33035192 - 33034961
Alignment:
| Q |
1 |
attgtgacttctctattttcacatttacggtgcctcaaaacgc-atgttcaaggtgcaaacgtgcatccaaacactcttttagtcacaacaacaacaatt |
99 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33035192 |
attgtaacttctctattttcacatttacagtgcctcaaaacgcgatgttcaaggtgcaaacgtgcatccaaacactcttttagtcacaacaactacaatt |
33035093 |
T |
|
| Q |
100 |
acaaccatttgttcaaagttccccaaaagtggaaaaacaaaaatgtatataatatcaacttagatcttatactatttttgcaatctttttggttacactt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33035092 |
gcaaccatttgttcaaacttccccaaaattggaaaaacaaaaatgtatataatatcaacttagatcttatactatttttgcaatctttttggttacactt |
33034993 |
T |
|
| Q |
200 |
tagttgataaattgtttggtcaaaagtattat |
231 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| |
|
|
| T |
33034992 |
tagttaatagattgtttggtcaaaagtattat |
33034961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University