View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17653_low_6 (Length: 236)
Name: NF17653_low_6
Description: NF17653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17653_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 23306163 - 23306382
Alignment:
| Q |
2 |
aagctcctctaactgtgaccctccgatttgattacttgctcaaaccacggctcttgccgacttgaactgctgcacacatgaattttaaccacccacacgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23306163 |
aagctcctctaactgtgaccctccgatttgattacttgctcaaaccacggctcttgccgacttgaactgctgcacacatgaattttaaccacccacacgt |
23306262 |
T |
 |
| Q |
102 |
caatttcaaccaccacacatactctgaaatcttagccatcggacacgctgcacactgattttaggtctcctatgctaaattgtaacaccagacgtcacaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||| |
|
|
| T |
23306263 |
caatttcaaccaccacacatactctgaaatcttagccatcgaacacgctgcacactgattttaggtctcctatgccaaattgtaacaccacatgtcacaa |
23306362 |
T |
 |
| Q |
202 |
gcttgaaattttttgtgttt |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
23306363 |
gcttgaaattttttgtgttt |
23306382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 160
Target Start/End: Original strand, 23553615 - 23553700
Alignment:
| Q |
74 |
cacacatgaattttaaccacc-cacacgtcaatttcaaccaccacacatactctgaaatcttagccatcggacacgctgcacactgat |
160 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||| ||| | ||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
23553615 |
cacacatggattttaaccaccgcacacggagatttcaaccacgacaaa--ctctgaaatcttaaccatcgcacacgctgcacgctgat |
23553700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University