View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17654_low_15 (Length: 240)
Name: NF17654_low_15
Description: NF17654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17654_low_15 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 27404440 - 27404676
Alignment:
| Q |
1 |
acaataatttaatgttttatatttttcactcgaaacaattggatatgttaacatatgtttaactttgaagaatcataaattaaaattggcttatctacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
27404440 |
acaataatttaatgttttatatttttcactcgaaataattggatatgttaacatatgtttaactctgaagaatcataaattaaaattggcttaactacag |
27404539 |
T |
|
| Q |
101 |
ttttggcccctatgttttacaatataatgattttgatatcctnnnnnnnncagaaataattttaacccttaaa--tttgcccccttttgcacttttaacc |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27404540 |
ttttgacccctatgttttacaatataatgattttgatatcctaaaaaaaacaaaaataattttaacccttaaatttttgcccccttttgcacttttaacc |
27404639 |
T |
|
| Q |
199 |
cctggtccaattttgatccgatcaatgcacatgtggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27404640 |
cctggtccaattttgatccgatcaatgcacatgtggt |
27404676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 158 - 224
Target Start/End: Complemental strand, 27405621 - 27405553
Alignment:
| Q |
158 |
aattttaacccttaaatttgcccccttttgcacttttaa--cccctggtccaattttgatccgatcaat |
224 |
Q |
| |
|
|||||||||||| || ||||||||||||| ||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
27405621 |
aattttaaccctcaagtttgcccccttttacacttttaatccccctggtttaattttgactcgatcaat |
27405553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 229
Target Start/End: Original strand, 122492 - 122555
Alignment:
| Q |
166 |
cccttaaatttgcccccttttgcacttttaacccctggtccaattttgatccgatcaatgcaca |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||| || |||||||||| |
|
|
| T |
122492 |
cccttaaatttacccccttttgcacttttgtcccctggtccaattttgacccactcaatgcaca |
122555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University