View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17655_high_12 (Length: 206)
Name: NF17655_high_12
Description: NF17655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17655_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 30877453 - 30877643
Alignment:
| Q |
16 |
cttataagtgcttaatttaggttttatccaaacatggagttaaattacttttctcaatgattaaagaaaggaagatgtaaaagcattatgttgaactaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30877453 |
cttataagtgcttaatttaggttttatccaaacatggagttaaattacttttctgaatgattaaagaaaggatgatgtaaaagcattatgttgaactaac |
30877552 |
T |
 |
| Q |
116 |
cttcaaagcacctggaatgacacaacgaagagtatcaagatgtgcattaatcctagctcttctcctcctttcggcctcactatgattcttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30877553 |
cttcaaagcacctggaatgacacaacgaagagtatcaagatgtgcattaatcctagctcttctcctcctttctgcctcactatgattcttc |
30877643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 106 - 206
Target Start/End: Original strand, 39332708 - 39332808
Alignment:
| Q |
106 |
ttgaactaaccttcaaagcacctggaatgacacaacgaagagtatcaagatgtgcattaatcctagctcttctcctcctttcggcctcactatgattctt |
205 |
Q |
| |
|
||||||||||||| ||| |||||||| |||| |||||| ||||||||||||| |||||| || ||||||||||| ||||| || |||||||||||||| |
|
|
| T |
39332708 |
ttgaactaaccttattagcccctggaataacactacgaagtgtatcaagatgtgaattaattcttgctcttctccttctttctgcttcactatgattctt |
39332807 |
T |
 |
| Q |
206 |
c |
206 |
Q |
| |
|
| |
|
|
| T |
39332808 |
c |
39332808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University