View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17655_low_12 (Length: 239)
Name: NF17655_low_12
Description: NF17655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17655_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 33117586 - 33117385
Alignment:
| Q |
14 |
aggtgcaatctcactttacaagttagttttatagagttgtattaaaccaaaccacatattctaatagttctatttcaatcttcattgattccttttcctc |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33117586 |
aggtgcaatctcactttacaaattagttttatggagttgtattaaaccaaaccacttattctaatagttctatttcaatcttgattgattccttttcctc |
33117487 |
T |
 |
| Q |
114 |
acgaagtctctgtgtttgattttgtatagtgtaattttggagggtaattgcacgggtatcaagtaaagtgtaaaataagagtgactacattaatactcaa |
213 |
Q |
| |
|
||||||||||||| ||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117486 |
acgaagtctctgtatttaattt------gtataattttggagggtaattgcacgggtatcaagtaaagtgtaaaataagagtgactacattaatactcaa |
33117393 |
T |
 |
| Q |
214 |
gtatagta |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
33117392 |
gtatagta |
33117385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University