View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17656_low_5 (Length: 202)
Name: NF17656_low_5
Description: NF17656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17656_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 54 - 184
Target Start/End: Complemental strand, 29673476 - 29673346
Alignment:
| Q |
54 |
aacaaggtattcgtggcattgtatgatgcatcaatacccctcattcataccccaccttgtcttgatcacttattggcaatgaaatcccaaacctttttaa |
153 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29673476 |
aacaaggtattcgtggcattgcatgatgcatcaatacccctcattcataccccaccttgtcttgatcacttattggcaatgaaatcccaaacctttttaa |
29673377 |
T |
 |
| Q |
154 |
tgagtcccctcttccattttcttaatcttac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29673376 |
tgagtcccctcttccattttcttaatcttac |
29673346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University