View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_high_30 (Length: 313)
Name: NF17657_high_30
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_high_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 313
Target Start/End: Original strand, 38506706 - 38507024
Alignment:
| Q |
7 |
atacacacctagtcgtgtcttctagcagtacttcacttcacaagct----------gaagaagaattcaaatcattctctgtnnnnnnnggaataaaatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38506706 |
atacacacctagtcgtgtcttctagcagtacttcacttcacaagctaaagctagctgaagaagaattcaaatcattctctgtaaaaaaaggaataaaatg |
38506805 |
T |
 |
| Q |
97 |
atgcaacgacaatcatggtcgtttaagtgt--gtgtatgactgaaaatgacagttcaagctcaaggcattgatgtgtttttagtgtcattaatttggatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38506806 |
atgcaacgacaatcatggtcgtttaagtgtgtgtgtatgactgaaaatgacagttcaagctcaaggcattgatgtgtttttagtgtcattaatctggatg |
38506905 |
T |
 |
| Q |
195 |
tgatctgatattgtctccatcaccaaatcatgacccaaaccatgtcctcttgcatttgccgggtgaaaaacgtttaatttctacacttcttttttacaat |
294 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38506906 |
ttatctgatattgtctccatcaccaaatcatgacccaaaccatgtcctcttgcatttgccgggtgaaaaacgtttaatttctactcttcttttttacaat |
38507005 |
T |
 |
| Q |
295 |
gcaagtgattgttgccttg |
313 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38507006 |
gcaagtgattgttgccttg |
38507024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University