View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_high_48 (Length: 254)
Name: NF17657_high_48
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 47639084 - 47639318
Alignment:
| Q |
18 |
aattctccttcaggacagaaatttgctgccaaagaagaaatattcttgggttctgttaaggtttattctttggcacagtgtacacctgatttgtctacgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639084 |
aattctccttcaggacagaaatttgctgccaaagaagaaatattcttgggttctgttaaggtttattctttggcacagtgtacacctgatttgtctacgt |
47639183 |
T |
 |
| Q |
118 |
ttgattgtaatacatgcttgcaaggtgccattagttctattggaaattgttgtaatgggaaacgcggtgcaagatcacttcttccgagttgtaatatacg |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47639184 |
ttgattgtaatacatgcttgcaaagtgccattagttctattggaaattgttgtaatgggaaacgcggtgcaagatcacttcttccgagttgtaatatacg |
47639283 |
T |
 |
| Q |
218 |
atatgaattttacccgttttataacgtctctgctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47639284 |
atatgaattttacccgttttataacgtttctgctg |
47639318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University