View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_high_54 (Length: 245)
Name: NF17657_high_54
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_high_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 102 - 227
Target Start/End: Original strand, 11358060 - 11358184
Alignment:
| Q |
102 |
gatggatcaaacctagacatggnnnnnnngttaatccactgagctacaccatcagaatagtttctgattttttgttgttgttatatacatgtaacatgcc |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11358060 |
gatggatcaaacctagacatggtttttttgttaatccactgagctacaccatcagaatagtttctgattttttgttgtt-ttatatacatgtaacatgcc |
11358158 |
T |
|
| Q |
202 |
atgttttagagtaatttgttcttttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
11358159 |
atgttttagagtaatttgttcttttt |
11358184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 34
Target Start/End: Original strand, 11357962 - 11357992
Alignment:
| Q |
4 |
gttgcagctaagcgtggccatttgggtatag |
34 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11357962 |
gttgcagctaagcgtggccatttgggtatag |
11357992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University