View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_high_58 (Length: 234)
Name: NF17657_high_58
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_high_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 208
Target Start/End: Complemental strand, 19412428 - 19412228
Alignment:
| Q |
8 |
aaaaagggacgtagggagtaataaatttagctaaagtccctttattatagcacacggccctattgtatagtccaacgattgcatgaaaggtgcatgcact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19412428 |
aaaaagggacgtagggagtaataaatttagctaaagtccctttattgtagcacacggccctattgtatagtccaacgattgcatgaaaggtgcatgcact |
19412329 |
T |
|
| Q |
108 |
atttaaggattgttcgtaagtttctttttctcttttgattatgtgattaatgatgttttcaaaggatgtgtggtggattattagagtatttaaaatgttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19412328 |
atttaaggattgttcgtaagtttctttttctcttttgattatgtgattaatgatgttttcaaaggatgtgtggtggattattagagtatttaaaatgttg |
19412229 |
T |
|
| Q |
208 |
t |
208 |
Q |
| |
|
| |
|
|
| T |
19412228 |
t |
19412228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 18161807 - 18161701
Alignment:
| Q |
107 |
tatttaaggattgttcgtaagtttctttttctcttttgattatgtgattaatgatgttt--------tcaaaggatgtgtggtggattattagagtattt |
198 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
18161807 |
tatttaaggatagttcgtaaatttccttttctcttttgattatgtgattaatgatgtttaattattgtcaaaggatgtgtggcgg---attagagtattt |
18161711 |
T |
|
| Q |
199 |
aaaatgttgt |
208 |
Q |
| |
|
|||||||||| |
|
|
| T |
18161710 |
aaaatgttgt |
18161701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University