View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_14 (Length: 424)
Name: NF17657_low_14
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 71 - 419
Target Start/End: Original strand, 3445211 - 3445558
Alignment:
| Q |
71 |
gtatgttagatgatgatataaaactatatgatagcgcttaatcgatgctatgatttatcgtttatgaacgttgataagatccttcgatctggcacagatc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3445211 |
gtatgttagatgatgatataaaactatatgatagcgcttaagcgatgctatgatttatcgtttatggacgttgataagatccttcgatctggcacagatc |
3445310 |
T |
|
| Q |
171 |
atcaattgggttggtttatgtcattttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaatttgcagtaggattcacgtgaatcaga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445311 |
atcaattgggttggtttatgtcattttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaatttgcagtaggattcacgtgaatcaga |
3445410 |
T |
|
| Q |
271 |
taatattattaatgttttagatatggtttttgttatgatgtatcttatcaacatgatgttgcatgtgtggattatgtcacaaaacatcctttgccatctc |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3445411 |
taatattattaatgttttagatatggtttttgttatgatgtatgttatcaacatgatgttgcatgtgt-gattatgtcacaaaacatcctttgccatctc |
3445509 |
T |
|
| Q |
371 |
tttcatgaatctggtttgtgaaggattcttaatgttctttgaatctctg |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445510 |
tttcatgaatctggtttgtgaaggattcttaatgttctttgaatctctg |
3445558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 3445158 - 3445192
Alignment:
| Q |
19 |
gggtgcaccattggcatcagttacttttcaggtaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445158 |
gggtgcaccattggcatcagttacttttcaggtaa |
3445192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University