View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_35 (Length: 299)
Name: NF17657_low_35
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 281
Target Start/End: Original strand, 46690845 - 46691112
Alignment:
| Q |
8 |
gagcagagagttgattaggataacacttgccacaatatctatttatggaggcataaagcaaattcgatcctggttttgaagacatgtttgtctctcttgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46690845 |
gagcagagagttgattaggataacacttgccaccatatctatttatggaggcataaagcaaattcgatcctggttttgaagatatgtttgtctctcttgt |
46690944 |
T |
 |
| Q |
108 |
aaaactctgcagcatgtaaatatttacatgaggtctaagacgagtgcatgagctgtcttgtagaaattgcaagtcatcgttaaggtgaggtatcaattac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
46690945 |
aaaactctgcagcatgtaaatatttacatgaggtctaagacgagtgcatgagctgtcttgtagaaattgcaagtcattgt----------tatcaattac |
46691034 |
T |
 |
| Q |
208 |
tagagagaaaatagattgg----acatacatcaacaacgatggtgctttcgtagaaattgaatatgatcaatggttgt |
281 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46691035 |
tagagagaaaatagattggacatacatacatcaacaacgatggtgctttcgtagaaattgaatatgatcaatgattgt |
46691112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University