View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_36 (Length: 297)
Name: NF17657_low_36
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 22042714 - 22042541
Alignment:
| Q |
1 |
ggttataacgataccatctcagccatattcttgatctcttccctttaagtaatgctctccaagagttctagtaagctaggagtatgaacacaaacacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22042714 |
ggttataacgataccatctcagccatattcttgatctcttccctttaagtaatgctctccaagagttctagtaagctaggagcatgaacacaaacacttc |
22042615 |
T |
 |
| Q |
101 |
tttagtgtttttgaagacataaatacattaccagatggcaagacatcattcagtatcaaacatttcaacatcag |
174 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22042614 |
tttagtgtttttgaagatataaatacattagcagatggcaagacatcattcagaatcaaacatttcaacatcag |
22042541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 173 - 297
Target Start/End: Complemental strand, 22042126 - 22042002
Alignment:
| Q |
173 |
agtagaattgaaaacgagactggtgcgtcaatttttggcaccgtgaacaaattcacaatgatatcacgtgttttctgttttgacaggttcatacatacaa |
272 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||||||||||||||||||||| ||||||| |||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
22042126 |
agtaaaattgtaaatgagactggtgcgtcaatttttggcaccgtgaacaatttcacaacgataccctgtgttttctattttgacaggttcatacatacaa |
22042027 |
T |
 |
| Q |
273 |
caatatcctggaggaatcaaattaa |
297 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
22042026 |
caatatcctggaggaatcaaattaa |
22042002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 82 - 174
Target Start/End: Original strand, 22016482 - 22016574
Alignment:
| Q |
82 |
gtatgaacacaaacacttgtttagtgtttttgaagacataaatacattaccagatggcaagacatcattcagtatcaaacatttcaacatcag |
174 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |||||| |||| ||||| ||||||||||||| | | ||| |||||||||||||| |
|
|
| T |
22016482 |
gtatgaacacaaatgcttctttagtgtttttgaagatataaatttattagtagatgccaagacatcattctgaagcaaccatttcaacatcag |
22016574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University