View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_38 (Length: 291)
Name: NF17657_low_38
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 1179043 - 1178767
Alignment:
| Q |
1 |
atgacattgatgatttagagaatgaattcgatgaagggcgaaatgaacaagatatgcaaatccacatgtctcctgaggtaatgcttcaaaatttattagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179043 |
atgacattgatgatttagagaatgaattcgatgaagggcgaaatgaacaagatatgcaaatccccatgtctcctgaggtaatgcttcaaaatttattagt |
1178944 |
T |
|
| Q |
101 |
ttgctgtcgtttatgttctaacattcgatgagtcaataggtcagtatagcttagtttaaatggcaatgtcgatattattagaccaaacacctttatcgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1178943 |
ttgctgtcgtttatgttctaacattcgatgaatcaataagtcagtatagcttagtttaaatggcaatgtcgatattattagaccgaacacctttatcggg |
1178844 |
T |
|
| Q |
201 |
ttttaacttggaacc----tagcagttgtgtgtgtagaatttaaattgtgtttgtcaccttcacattcagaggttta |
273 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1178843 |
ttttaacttggaacctagctagcagttgtgtgtgtagaatttaaattgtgtttgtcaccttcacattcagaggttta |
1178767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University