View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17657_low_42 (Length: 274)
Name: NF17657_low_42
Description: NF17657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17657_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 7 - 256
Target Start/End: Original strand, 41291812 - 41292061
Alignment:
| Q |
7 |
ctgaaatgaatctcagacattgatcctgtaattaatgaaagctgcttcttttctgtttggctcttgcatgctttacctacttcagcataacgagcagtaa |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291812 |
ctgaactgaatctcagacattgatcctgtaattaatgaaagctgcttcttttctgtttggctcttgcatgctttacctacttcagcataacgagcagtaa |
41291911 |
T |
 |
| Q |
107 |
ccctagctagcatagtaggattaggatggtcctaaccaataaccacaaatatactactattgtacgagtaaataaagttatttttatacacataaagaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291912 |
ccctagctagcatagtaggattaggatggtcctaaccaataaccacaaatatactactattgtacgagtaaataaagttatttttatacacataaagaaa |
41292011 |
T |
 |
| Q |
207 |
tatgaaagtggaccaccctatcatagcctggttgtgtggcacgttgttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41292012 |
tatgaaagtggaccaccctatcatagcctggttgtgtggcacgttgttct |
41292061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University